Detail of EST/Unigene CX529519 |
Acc. | CX529519 |
Internal Acc. | s13dNF97B06MJ045_245089 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional dethiobiotin synthetase/7,8-diamino-pelargonic acid aminotransferase, mitochondrial OS=Arabidopsis thaliana E-value=2e-36; Bifunctional dethiobiotin synthetase/7,8-diamino-pelargonic acid aminotransferase, mitochondrial OS=Oryza sativa subsp. japonica E-value=2e-24; |
Length | 480 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
Sequence | CTCAAACCTCTTCAAACCGGTTTCCCTTCCGACTCCGATTCCCGCTTCATCTTCAATAAA |
EST members of Unigene | CX529519 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34976.1.S1_at
|
Corresponding NCBI Gene | 835863 |
Trichome-related Gene from Literature | N/A |