Detail of EST/Unigene CX531305 |
Acc. | CX531305 |
Internal Acc. | s13dNF04B08MJ061_248727 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | ATPase family AAA domain-containing protein 5 OS=Mus musculus E-value=1e-13; ATPase family AAA domain-containing protein 5 OS=Homo sapiens E-value=3e-13; Chromosome transmission fidelity protein 18 OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) E-value=2e-08; Replication factor C large subunit OS=Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) E-value=2e-07; Replication factor C large subunit OS=Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938) E-value=3e-06; |
Length | 624 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
Sequence | GAAAGGCGGTATCAAAACAGAAAGGATTCCTCTAACAAGGATCAAACTGACATACCAGAC |
EST members of Unigene | CX531305 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10754 replication factor C subunit 1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10754 replication factor C subunit 1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10754 replication factor C subunit 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.35030.1.S1_at
|
Corresponding NCBI Gene | 844097 |
Trichome-related Gene from Literature | N/A |