Detail of EST/Unigene CX531529 |
Acc. | CX531529 |
Internal Acc. | s13dNF23E09MJ068_257007 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 9-cis-epoxycarotenoid dioxygenase NCED1, chloroplastic OS=Phaseolus vulgaris E-value=7e-84; 9-cis-epoxycarotenoid dioxygenase NCED3, chloroplastic OS=Arabidopsis thaliana E-value=7e-77; 9-cis-epoxycarotenoid dioxygenase NCED9, chloroplastic OS=Arabidopsis thaliana E-value=6e-73; Probable 9-cis-epoxycarotenoid dioxygenase NCED5, chloroplastic OS=Arabidopsis thaliana E-value=1e-72; 9-cis-epoxycarotenoid dioxygenase 1, chloroplastic OS=Zea mays E-value=9e-66; |
Length | 519 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
Sequence | AGTGTTTCTGTTTTCATCTGTGGAATGCGTGGGAAGAGCCTGAAAATGATGAAGTTGTGG |
EST members of Unigene | CX531529 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.14.99.36 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.35044.1.S1_at
|
Corresponding NCBI Gene | 820667 |
Trichome-related Gene from Literature | N/A |