| Detail of EST/Unigene CX532738 |
| Acc. | CX532738 |
| Internal Acc. | s13dNF48E02MJ007_271759 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=7e-54; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=9e-54; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=7e-53; Alternative oxidase 1, mitochondrial OS=Glycine max E-value=8e-49; Alternative oxidase 1b, mitochondrial OS=Arabidopsis thaliana E-value=1e-47; |
| Length | 624 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
| Sequence | AAACCTCTCTCTCTCTTTCTCTAATATTCTTTCACAAATTCATTCTTTCTTGCCGTTTTC |
| EST members of Unigene | CX532738 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.43158.1.S1_s_at
|
| Corresponding NCBI Gene | 821806 |
| Trichome-related Gene from Literature | N/A |