Detail of EST/Unigene CX533166 |
Acc. | CX533166 |
Internal Acc. | s13dNF0CG02MJ008_319495 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH9 OS=Arabidopsis thaliana E-value=7e-73; Histone-lysine N-methyltransferase, H3 lysine-9, H3 lysine-27, H4 lysine-20 and cytosine specific SUVH2 OS=Arabidopsis thaliana E-value=5e-71; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH5 OS=Arabidopsis thaliana E-value=5e-37; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH6 OS=Arabidopsis thaliana E-value=4e-36; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH1 OS=Nicotiana tabacum E-value=3e-34; |
Length | 648 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
Sequence | CTGGTTTGAAGAAGGGAAATATGGTTTTAGAGTTTTTAAGTATAAGTTATTGAGAGTTGA |
EST members of Unigene | CX533166 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00310 Lysine degradation > K11420 euchromatic histone-lysine N-methyltransferase |
EC | 2.1.1.43 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.6993.1.S1_at
|
Corresponding NCBI Gene | 826978 |
Trichome-related Gene from Literature | N/A |