| Detail of EST/Unigene CX533923 |
| Acc. | CX533923 |
| Internal Acc. | s13dNF0AG01MJ004_321611 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 39S ribosomal protein L46, mitochondrial OS=Bos taurus E-value=2e-07; 39S ribosomal protein L46, mitochondrial OS=Pongo abelii E-value=3e-07; 39S ribosomal protein L46, mitochondrial OS=Homo sapiens E-value=3e-07; 39S ribosomal protein L46, mitochondrial OS=Mus musculus E-value=5e-07; 39S ribosomal protein L46, mitochondrial OS=Rattus norvegicus E-value=1e-06; |
| Length | 620 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
| Sequence | GTGAAATATTAACGTTTTATTTCTCTTTTCTCTTTTAAGATAGAAAAAAATGAGGTTAAT |
| EST members of Unigene | CX533923 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.7008.1.S1_at
|
| Corresponding NCBI Gene | 838024 |
| Trichome-related Gene from Literature | N/A |