Detail of EST/Unigene CX533923 |
Acc. | CX533923 |
Internal Acc. | s13dNF0AG01MJ004_321611 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 39S ribosomal protein L46, mitochondrial OS=Bos taurus E-value=2e-07; 39S ribosomal protein L46, mitochondrial OS=Pongo abelii E-value=3e-07; 39S ribosomal protein L46, mitochondrial OS=Homo sapiens E-value=3e-07; 39S ribosomal protein L46, mitochondrial OS=Mus musculus E-value=5e-07; 39S ribosomal protein L46, mitochondrial OS=Rattus norvegicus E-value=1e-06; |
Length | 620 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
Sequence | GTGAAATATTAACGTTTTATTTCTCTTTTCTCTTTTAAGATAGAAAAAAATGAGGTTAAT |
EST members of Unigene | CX533923 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.7008.1.S1_at
|
Corresponding NCBI Gene | 838024 |
Trichome-related Gene from Literature | N/A |