Detail of EST/Unigene CX534413 |
Acc. | CX534413 |
Internal Acc. | s13dNF0RE08MJ067_322580 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor G, mitochondrial OS=Arabidopsis thaliana E-value=0; Elongation factor G, mitochondrial OS=Oryza sativa subsp. japonica E-value=0; Elongation factor G, mitochondrial OS=Aspergillus oryzae (strain ATCC 42149 / RIB 40) E-value=1e-69; Elongation factor G, mitochondrial OS=Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / NRRL 3357 / JCM 12722 / SRRC 167) E-value=1e-69; Elongation factor G, mitochondrial OS=Penicillium marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333) E-value=2e-69; |
Length | 661 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
Sequence | CAGAGGTTGATGATATACTTGCGGAAGCGTTTCTTAGTGATGAGCCTGTTTCAGATGTTG |
EST members of Unigene | CX534413 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.5.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.44772.1.S1_at
|
Corresponding NCBI Gene | 819110 |
Trichome-related Gene from Literature | N/A |