Detail of EST/Unigene CX534612 |
Acc. | CX534612 |
Internal Acc. | s13dNF74F05MJ047_330925 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Histone-lysine N-methyltransferase, H3 lysine-9, H3 lysine-27, H4 lysine-20 and cytosine specific SUVH2 OS=Arabidopsis thaliana E-value=5e-32; Probable histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH9 OS=Arabidopsis thaliana E-value=1e-31; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH6 OS=Arabidopsis thaliana E-value=9e-12; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH5 OS=Arabidopsis thaliana E-value=2e-11; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH1 OS=Arabidopsis thaliana E-value=2e-10; |
Length | 571 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
Sequence | GTGCGTCCATCGTATCCCTCAATTCCTCCTTTAGATTATTCTCTGGATGTATCAACAATG |
EST members of Unigene | CX534612 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00310 Lysine degradation > K11421 histone-lysine N-methyltransferase SETDB |
EC | 2.1.1.43 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.35165.1.S1_at
|
Corresponding NCBI Gene | 817892 |
Trichome-related Gene from Literature | 817892 |