| Detail of EST/Unigene CX534612 |
| Acc. | CX534612 |
| Internal Acc. | s13dNF74F05MJ047_330925 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Histone-lysine N-methyltransferase, H3 lysine-9, H3 lysine-27, H4 lysine-20 and cytosine specific SUVH2 OS=Arabidopsis thaliana E-value=5e-32; Probable histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH9 OS=Arabidopsis thaliana E-value=1e-31; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH6 OS=Arabidopsis thaliana E-value=9e-12; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH5 OS=Arabidopsis thaliana E-value=2e-11; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH1 OS=Arabidopsis thaliana E-value=2e-10; |
| Length | 571 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); |
| Sequence | GTGCGTCCATCGTATCCCTCAATTCCTCCTTTAGATTATTCTCTGGATGTATCAACAATG |
| EST members of Unigene | CX534612 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00310 Lysine degradation > K11421 histone-lysine N-methyltransferase SETDB |
| EC | 2.1.1.43 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.35165.1.S1_at
|
| Corresponding NCBI Gene | 817892 |
| Trichome-related Gene from Literature | 817892 |