Detail of EST/Unigene CX536097 |
Acc. | CX536097 |
Internal Acc. | s13dNF02G04GS035_455366 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase gamma chain, chloroplastic OS=Nicotiana tabacum E-value=2e-15; ATP synthase subunit gamma, chloroplastic OS=Zea mays E-value=1e-13; ATP synthase gamma chain 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-12; ATP synthase gamma chain 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-12; ATP synthase gamma chain, chloroplastic OS=Spinacia oleracea E-value=6e-11; |
Length | 320 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GCCTCGTGCCGAATTCGGCACGAGGGTCAAATCTTGAGGGCTTTGCAGGAATCACTTGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.3.14 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838139 |
Trichome-related Gene from Literature | N/A |