| Detail of EST/Unigene CX536847 |
| Acc. | CX536847 |
| Internal Acc. | s13dNF11A05GS036_456872 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Inosine triphosphate pyrophosphatase OS=Vitis vinifera E-value=3e-71; Inosine triphosphate pyrophosphatase OS=Arabidopsis thaliana E-value=7e-68; Inosine triphosphate pyrophosphatase OS=Sorghum bicolor E-value=3e-63; Inosine triphosphate pyrophosphatase OS=Zea mays E-value=4e-62; Inosine triphosphate pyrophosphatase OS=Oryza sativa subsp. japonica E-value=2e-61; |
| Length | 502 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GCCTCGTGCCGAATTCGGCACGAGGTTTGGCTGCTATTCAGGTTAAAGGACCTGTTTTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01519 nucleoside-triphosphate pyrophosphatase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01519 nucleoside-triphosphate pyrophosphatase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01519 nucleoside-triphosphate pyrophosphatase |
| EC | 3.-.-.- 3.6.1.19 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827006 |
| Trichome-related Gene from Literature | N/A |