Detail of EST/Unigene CX537456 |
Acc. | CX537456 |
Internal Acc. | s13dNF51B10GS077_458132 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Calvin cycle protein CP12-2, chloroplastic OS=Arabidopsis thaliana E-value=8e-27; Calvin cycle protein CP12-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-26; Calvin cycle protein CP12-3, chloroplastic OS=Arabidopsis thaliana E-value=6e-13; Calvin cycle protein CP12, chloroplastic OS=Chlamydomonas reinhardtii E-value=3e-12; |
Length | 248 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GGTTGAAGAGAGCATAAAGAGTGCACAAGAGACGTGTGCTGATGACCCAGTTAGTGGAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825414 |
Trichome-related Gene from Literature | N/A |