| Detail of EST/Unigene CX537906 |
| Acc. | CX537906 |
| Internal Acc. | s13dNF38C07GS050_459050 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L12, chloroplastic OS=Nicotiana tabacum E-value=6e-14; 50S ribosomal protein L12, chloroplastic OS=Nicotiana sylvestris E-value=6e-14; 50S ribosomal protein L12, chloroplastic OS=Spinacia oleracea E-value=5e-13; 50S ribosomal protein L12, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-12; 50S ribosomal protein L12-3, chloroplastic OS=Arabidopsis thaliana E-value=2e-12; |
| Length | 332 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GCCTCGTGCCGAATTCGGCACGAGGTGGGATTGAAAGAAGCGAAGGAATTGATTGAAGGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822403 |
| Trichome-related Gene from Literature | N/A |