Detail of EST/Unigene CX537906 |
Acc. | CX537906 |
Internal Acc. | s13dNF38C07GS050_459050 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L12, chloroplastic OS=Nicotiana tabacum E-value=6e-14; 50S ribosomal protein L12, chloroplastic OS=Nicotiana sylvestris E-value=6e-14; 50S ribosomal protein L12, chloroplastic OS=Spinacia oleracea E-value=5e-13; 50S ribosomal protein L12, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-12; 50S ribosomal protein L12-3, chloroplastic OS=Arabidopsis thaliana E-value=2e-12; |
Length | 332 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GCCTCGTGCCGAATTCGGCACGAGGTGGGATTGAAAGAAGCGAAGGAATTGATTGAAGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822403 |
Trichome-related Gene from Literature | N/A |