| Detail of EST/Unigene CX538002 |
| Acc. | CX538002 |
| Internal Acc. | s13dNF54C12GS086_459244 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit XI, chloroplastic OS=Arabidopsis thaliana E-value=2e-27; Photosystem I reaction center subunit XI, chloroplastic OS=Cucumis sativus E-value=2e-26; Photosystem I reaction center subunit XI, chloroplastic OS=Spinacia oleracea E-value=1e-23; Photosystem I reaction center subunit XI, chloroplastic OS=Hordeum vulgare E-value=5e-23; |
| Length | 334 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GATTTGCCTTACAATCTATGGAGTTTCATCATTCAATGAAGGTGATCCATCAATTGCTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826892 |
| Trichome-related Gene from Literature | N/A |