| Detail of EST/Unigene CX538429 |
| Acc. | CX538429 |
| Internal Acc. | s13dNF79C07GS050_460110 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | DNA ligase 1 OS=Dictyostelium discoideum E-value=6e-11; Nucleolar protein 58 OS=Dictyostelium discoideum E-value=6e-10; Myb-like protein X OS=Dictyostelium discoideum E-value=4e-09; Transcriptional regulator ATRX homolog OS=Caenorhabditis elegans E-value=5e-09; Dynein heavy chain-like protein PF11_0240 OS=Plasmodium falciparum (isolate 3D7) E-value=7e-09; |
| Length | 632 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GGAATAATGATCAGCCAAAGAAGAACTCAAATGGTGGTGCCAAAGAAGAGAAAGTTCTTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03410 Base excision repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10747 DNA ligase 1 |
| EC | 5.99.1.2 6.5.1.1 |
| Transcription Factor Family | NF-YB |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822509 |
| Trichome-related Gene from Literature | N/A |