Detail of EST/Unigene CX538641 |
Acc. | CX538641 |
Internal Acc. | s13dNF81H02GS016_460534 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=6e-46; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=2e-43; Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=7e-20; Chlorophyll a-b binding protein 4, chloroplastic OS=Arabidopsis thaliana E-value=2e-19; Chlorophyll a-b binding protein CP24 10B, chloroplastic OS=Solanum lycopersicum E-value=5e-18; |
Length | 463 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GCCAAAACTCACAAAACTTACTCACTTTTATCCCTTGAGGGCAAGAACAGTATCATGGCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825320 |
Trichome-related Gene from Literature | N/A |