Detail of EST/Unigene CX538728 |
Acc. | CX538728 |
Internal Acc. | s13dNF0IG10GS072_460708 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Alcohol dehydrogenase class-3 OS=Oryctolagus cuniculus E-value=1e-32; Alcohol dehydrogenase class-3 chain H OS=Gadus morhua E-value=1e-32; Alcohol dehydrogenase class-3 OS=Mus musculus E-value=4e-32; S-(hydroxymethyl)glutathione dehydrogenase OS=Shigella sonnei (strain Ss046) E-value=6e-32; S-(hydroxymethyl)glutathione dehydrogenase OS=Escherichia coli (strain UTI89 / UPEC) E-value=6e-32; |
Length | 515 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (1 ESTs); |
Sequence | TAGTCTCTGCCACACAGATTTCTCAAGCACTCAAGGATTTCCACATAATAAATTCCCCCT |
EST members of Unigene | CX538728 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
EC | 1.1.1.1 1.1.1.284 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.7063.1.S1_at
|
Corresponding NCBI Gene | 834230 |
Trichome-related Gene from Literature | N/A |