| Detail of EST/Unigene CX538837 |
| Acc. | CX538837 |
| Internal Acc. | s13dNF0GA09GS065_460930 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Lycopene epsilon cyclase, chloroplastic OS=Arabidopsis thaliana E-value=5e-80; Lycopene epsilon cyclase, chloroplastic OS=Solanum lycopersicum E-value=2e-78; Lycopene beta cyclase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=4e-38; Lycopene beta cyclase, chloroplastic OS=Solanum lycopersicum E-value=2e-37; Lycopene beta cyclase, chloroplastic/chromoplastic OS=Narcissus pseudonarcissus E-value=7e-37; |
| Length | 610 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GGTTGAAAACAGTCCTTATGATCCAAACGTGATGGTTTTCATGGATTACAGAGACTATAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835806 |
| Trichome-related Gene from Literature | N/A |