Detail of EST/Unigene CX538837 |
Acc. | CX538837 |
Internal Acc. | s13dNF0GA09GS065_460930 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Lycopene epsilon cyclase, chloroplastic OS=Arabidopsis thaliana E-value=5e-80; Lycopene epsilon cyclase, chloroplastic OS=Solanum lycopersicum E-value=2e-78; Lycopene beta cyclase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=4e-38; Lycopene beta cyclase, chloroplastic OS=Solanum lycopersicum E-value=2e-37; Lycopene beta cyclase, chloroplastic/chromoplastic OS=Narcissus pseudonarcissus E-value=7e-37; |
Length | 610 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GGTTGAAAACAGTCCTTATGATCCAAACGTGATGGTTTTCATGGATTACAGAGACTATAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835806 |
Trichome-related Gene from Literature | N/A |