| Detail of EST/Unigene CX538871 |
| Acc. | CX538871 |
| Internal Acc. | s13dNF0GD12GS094_460998 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Plastidial pyruvate kinase 2 OS=Arabidopsis thaliana E-value=3e-57; Pyruvate kinase isozyme G, chloroplastic (Fragment) OS=Ricinus communis E-value=2e-44; Plastidial pyruvate kinase 3, chloroplastic OS=Arabidopsis thaliana E-value=9e-44; Pyruvate kinase isozyme G, chloroplastic OS=Nicotiana tabacum E-value=7e-42; Plastidial pyruvate kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-13; |
| Length | 581 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GATATTGGTCAAGTGTTCAAGAATCACATGAGTGAGATGTTTGCATACCATGCAACCATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.7.1.40 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835369 |
| Trichome-related Gene from Literature | N/A |