Detail of EST/Unigene CX538963 |
Acc. | CX538963 |
Internal Acc. | s13dNF45E12GS087_461186 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 6, chloroplastic OS=Arabidopsis thaliana E-value=3e-41; Chlorophyll a-b binding protein 1B-21, chloroplastic OS=Hordeum vulgare Ib-21 E-value=4e-39; Chlorophyll a-b binding protein 6A, chloroplastic OS=Solanum lycopersicum E-value=1e-38; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=1e-16; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-16; |
Length | 418 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GCACCAAAGGAGTATGGAGAAAGACCCTGAAAAGAAGAAATACCCTGGTGGTGCTTTTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824654 |
Trichome-related Gene from Literature | N/A |