| Detail of EST/Unigene CX539009 |
| Acc. | CX539009 |
| Internal Acc. | s13dNF47A11GS081_461278 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Prolycopene isomerase 2, chloroplastic OS=Oncidium hybrid cultivar E-value=5e-20; Prolycopene isomerase 1, chloroplastic OS=Oncidium hybrid cultivar E-value=5e-20; Prolycopene isomerase, chloroplastic OS=Arabidopsis thaliana E-value=3e-19; Prolycopene isomerase, chloroplastic OS=Daucus carota E-value=3e-18; Prolycopene isomerase, chloroplastic OS=Solanum lycopersicum E-value=7e-18; |
| Length | 402 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GAATGTTGTGTTGATATCAGTTCCTAGTGTACTTACTCCTAATCTGGCACCTATTGGAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842152 |
| Trichome-related Gene from Literature | N/A |