Detail of EST/Unigene CX539025 |
Acc. | CX539025 |
Internal Acc. | s13dNF47C04GS022_461310 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=4e-70; Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum E-value=1e-67; Chlorophyll a-b binding protein 4, chloroplastic OS=Arabidopsis thaliana E-value=5e-19; Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=2e-18; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=4e-17; |
Length | 598 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GAGCAGCCGGAGCTATAGCACCTGAAATTCTTGGCAAAGCAGGTTTAATTCCCGCGGAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842446 |
Trichome-related Gene from Literature | N/A |