| Detail of EST/Unigene CX539025 |
| Acc. | CX539025 |
| Internal Acc. | s13dNF47C04GS022_461310 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=4e-70; Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum E-value=1e-67; Chlorophyll a-b binding protein 4, chloroplastic OS=Arabidopsis thaliana E-value=5e-19; Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=2e-18; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=4e-17; |
| Length | 598 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GAGCAGCCGGAGCTATAGCACCTGAAATTCTTGGCAAAGCAGGTTTAATTCCCGCGGAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842446 |
| Trichome-related Gene from Literature | N/A |