| Detail of EST/Unigene CX539028 |
| Acc. | CX539028 |
| Internal Acc. | s13dNF47C07GS050_461316 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mannosyl-oligosaccharide 1,2-alpha-mannosidase MNS3 OS=Arabidopsis thaliana E-value=3e-75; Mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Candida albicans E-value=7e-39; Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=7e-33; Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-31; Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase OS=Homo sapiens E-value=2e-28; |
| Length | 513 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GTAAAGACTCTTCCAAAGGTTGAAGGACTAGTCCCTATCTACATTAGCCCTGATTCTGGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00513 High-mannose type N-glycan biosynthesis > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00510 N-Glycan biosynthesis > K01230 mannosyl-oligosaccharide alpha-1,2-mannosidase |
| EC | 3.2.1.113 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839879 |
| Trichome-related Gene from Literature | N/A |