| Detail of EST/Unigene CX539043 |
| Acc. | CX539043 |
| Internal Acc. | s13dNF47D11GS090_461346 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Peroxiredoxin Q, chloroplastic OS=Populus jackii E-value=5e-56; Peroxiredoxin Q, chloroplastic (Fragment) OS=Sedum lineare E-value=4e-55; Peroxiredoxin Q, chloroplastic OS=Triticum aestivum E-value=5e-55; Peroxiredoxin Q, chloroplastic OS=Suaeda salsa E-value=8e-55; Peroxiredoxin Q, chloroplastic OS=Gentiana triflora E-value=2e-54; |
| Length | 616 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GCTCATATCATAATCTATCTATCTCTATCTACCACCCCATAAGGAAAAGAAAACACAACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.11.1.15 1.11.1.7 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |