| Detail of EST/Unigene CX539062 |
| Acc. | CX539062 |
| Internal Acc. | s13dNF47F07GS059_461384 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit a, chloroplastic OS=Triticum aestivum E-value=5e-12; ATP synthase subunit a, chloroplastic OS=Vitis vinifera E-value=5e-12; ATP synthase subunit a, chloroplastic OS=Trachelium caeruleum E-value=5e-12; ATP synthase subunit a, chloroplastic OS=Staurastrum punctulatum E-value=5e-12; ATP synthase subunit a, chloroplastic OS=Glycine max E-value=5e-12; |
| Length | 607 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GCCTCGTGCCGCGGAAATATATTAGCTGATGAATTAGTAGTTGTTGTTCTTGTTTCGTTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |