Detail of EST/Unigene CX539320 |
Acc. | CX539320 |
Internal Acc. | s13dNF64F04GS031_461900 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Nucleolar protein 58 OS=Dictyostelium discoideum E-value=7e-11; Dynein heavy chain-like protein PF11_0240 OS=Plasmodium falciparum (isolate 3D7) E-value=3e-10; DNA ligase 1 OS=Dictyostelium discoideum E-value=3e-10; High mobility group nucleosome-binding domain-containing protein 5 OS=Mus musculus E-value=1e-09; Protein MNN4 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=1e-08; |
Length | 552 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GCTTCTGAGAAAATAAAAGAAACGACGGTGCCTAAGTCAGAGAAAGTACTAGAAGAGAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03410 Base excision repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10747 DNA ligase 1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10747 DNA ligase 1 |
EC | |
Transcription Factor Family | NF-YB |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822509 |
Trichome-related Gene from Literature | N/A |