Detail of EST/Unigene CX539492 |
Acc. | CX539492 |
Internal Acc. | s13dNF61E10GS071_462244 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phospholipase A1-Igamma3, chloroplastic OS=Arabidopsis thaliana E-value=4e-85; Phospholipase A1-Igamma1, chloroplastic OS=Arabidopsis thaliana E-value=5e-59; Phospholipase A1-Igamma2, chloroplastic OS=Arabidopsis thaliana E-value=9e-57; Galactolipase DONGLE, chloroplastic OS=Arabidopsis thaliana E-value=1e-41; Phospholipase A1-Ialpha2, chloroplastic OS=Arabidopsis thaliana E-value=2e-41; |
Length | 627 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GATACGACCTAAAAGACATACTACACGAAGCAAACTTCAAAAACGACCCATCAATCAAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841569 |
Trichome-related Gene from Literature | N/A |