Detail of EST/Unigene CX539567 |
Acc. | CX539567 |
Internal Acc. | s13dNF65D12GS094_462396 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=0; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Glycine max E-value=0; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=0; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=0; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=7e-97; |
Length | 645 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GAGAAGATGTACAAGAGTTTAGACAACATGACAAAAACAATGAGATTTACTTTTCCATTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830441 |
Trichome-related Gene from Literature | N/A |