Detail of EST/Unigene CX539948 |
Acc. | CX539948 |
Internal Acc. | s13dNF43A08GS053_463168 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=5e-32; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=4e-27; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=3e-16; Glucan endo-1,3-beta-glucosidase-like protein 3 OS=Arabidopsis thaliana E-value=3e-14; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=4e-14; |
Length | 643 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GGAGAATCAGAAACCTGGTCCGATTGCTGAGCGTAATTGGGGTCTCTTTCGGCCTGATTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818547 |
Trichome-related Gene from Literature | N/A |