| Detail of EST/Unigene CX539951 |
| Acc. | CX539951 |
| Internal Acc. | s13dNF43A11GS081_463174 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable alpha-galactosidase B OS=Talaromyces emersonii E-value=5e-06; |
| Length | 632 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | ATGCCTTTTCTTGGATAATTTCTGAAGAAGAATTCTTACAAAATGCTGAATTAGTTTCTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01189 alpha-galactosidase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K01189 alpha-galactosidase; Metabolism > Lipid Metabolism > ko00600 Sphingolipid metabolism > K01189 alpha-galactosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00603 Glycosphingolipid biosynthesis - globoseries > K01189 alpha-galactosidase |
| EC | 3.2.1.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822242 |
| Trichome-related Gene from Literature | N/A |