Detail of EST/Unigene CX540029 |
Acc. | CX540029 |
Internal Acc. | s13dNF46A04GS021_463330 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=9e-16; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=2e-12; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=2e-08; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=5e-06; Glucan endo-1,3-beta-glucosidase 9 OS=Arabidopsis thaliana E-value=9e-06; |
Length | 545 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GACTTAGTCTCGCATGCTTCATATGCTTTTAATAGCTATTACCAGCAAAATGGTGCTTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835760 |
Trichome-related Gene from Literature | N/A |