| Detail of EST/Unigene CX540135 |
| Acc. | CX540135 |
| Internal Acc. | s13dNF59B12GS096_463542 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aminomethyltransferase, mitochondrial OS=Pisum sativum E-value=6e-33; Aminomethyltransferase, mitochondrial OS=Solanum tuberosum E-value=2e-28; Aminomethyltransferase, mitochondrial OS=Flaveria trinervia E-value=4e-28; Aminomethyltransferase, mitochondrial OS=Flaveria pringlei E-value=4e-28; Aminomethyltransferase, mitochondrial OS=Flaveria anomala E-value=4e-28; |
| Length | 304 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GCATTGAGATTCAAGATGAAGGAGGCAACAACATTGGTGAAGTCACTAGTGGTGGATTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K00605 aminomethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00605 aminomethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00605 aminomethyltransferase |
| EC | 2.1.2.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837733 |
| Trichome-related Gene from Literature | N/A |