| Detail of EST/Unigene CX540177 |
| Acc. | CX540177 |
| Internal Acc. | s13dNF59H01GS015_463626 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=2e-08; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Trifolium repens E-value=2e-07; Ribulose bisphosphate carboxylase small chain 1, chloroplastic OS=Glycine max E-value=3e-06; |
| Length | 133 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GGAGTACTTGGTGAACTAACAAGGAGTAGGAAAAATGGCTTTGATCTCCTCCGCCGCTGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |