Detail of EST/Unigene CX540177 |
Acc. | CX540177 |
Internal Acc. | s13dNF59H01GS015_463626 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=2e-08; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Trifolium repens E-value=2e-07; Ribulose bisphosphate carboxylase small chain 1, chloroplastic OS=Glycine max E-value=3e-06; |
Length | 133 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GGAGTACTTGGTGAACTAACAAGGAGTAGGAAAAATGGCTTTGATCTCCTCCGCCGCTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |