Detail of EST/Unigene CX540178 |
Acc. | CX540178 |
Internal Acc. | s13dNF59H02GS027_463628 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L9, chloroplastic OS=Pisum sativum E-value=1e-23; 50S ribosomal protein L9, chloroplastic OS=Arabidopsis thaliana E-value=7e-17; 50S ribosomal protein L9, chloroplastic OS=Ipomoea trifida E-value=4e-15; 50S ribosomal protein L9, chloroplastic OS=Triticum aestivum E-value=1e-11; 50S ribosomal protein L9 OS=Synechococcus sp. (strain CC9902) E-value=7e-07; |
Length | 391 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GAACAAAACAACAATGGCATCATCATCAACATTATCTTCACTTCCATTGCAACATAGTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823623 |
Trichome-related Gene from Literature | N/A |