| Detail of EST/Unigene CX540363 |
| Acc. | CX540363 |
| Internal Acc. | s13dNF74C05GS037_464000 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phospholipid hydroperoxide glutathione peroxidase, chloroplastic OS=Pisum sativum E-value=5e-79; Phospholipid hydroperoxide glutathione peroxidase 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-57; Putative glutathione peroxidase 7, chloroplastic OS=Arabidopsis thaliana E-value=2e-53; Probable phospholipid hydroperoxide glutathione peroxidase 6, mitochondrial OS=Arabidopsis thaliana E-value=1e-44; Probable phospholipid hydroperoxide glutathione peroxidase OS=Mesembryanthemum crystallinum E-value=1e-43; |
| Length | 583 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GGAACAACGCAAAATGGTTTCCATGGCTTCTTCCACAACATTCTTCACACCTCTTCACAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
| EC | 1.11.1.12 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817046 |
| Trichome-related Gene from Literature | N/A |