| Detail of EST/Unigene CX540488 |
| Acc. | CX540488 |
| Internal Acc. | s13dNF49H06GS048_464252 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=1e-40; Cytochrome P450 71A1 OS=Persea americana E-value=3e-38; Cytochrome P450 71A9 OS=Glycine max E-value=1e-37; Cytochrome P450 71B26 OS=Arabidopsis thaliana E-value=2e-33; Cytochrome P450 71B10 OS=Arabidopsis thaliana E-value=3e-33; |
| Length | 580 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GTTGATGACAGCTTTCTTTGTTTCTGATTATATTACATTCATGAGTTGGATTGATAAACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829277 |
| Trichome-related Gene from Literature | N/A |