Detail of EST/Unigene CX540488 |
Acc. | CX540488 |
Internal Acc. | s13dNF49H06GS048_464252 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=1e-40; Cytochrome P450 71A1 OS=Persea americana E-value=3e-38; Cytochrome P450 71A9 OS=Glycine max E-value=1e-37; Cytochrome P450 71B26 OS=Arabidopsis thaliana E-value=2e-33; Cytochrome P450 71B10 OS=Arabidopsis thaliana E-value=3e-33; |
Length | 580 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GTTGATGACAGCTTTCTTTGTTTCTGATTATATTACATTCATGAGTTGGATTGATAAACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829277 |
Trichome-related Gene from Literature | N/A |