Detail of EST/Unigene CX540555 |
Acc. | CX540555 |
Internal Acc. | s13dNF50H10GS080_464386 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | GDT1-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-31; GDT1-like protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-25; GDT1-like protein 4 OS=Arabidopsis thaliana E-value=2e-06; GDT1-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-06; GDT1-like protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-06; |
Length | 312 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | TCGATGACAGTTCATCTAAAATCTCTGAAAGAAATTCTGTCGATGACAGTTCATCTAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826992 |
Trichome-related Gene from Literature | N/A |