Detail of EST/Unigene CX540663 |
Acc. | CX540663 |
Internal Acc. | s13dNF55C09GS070_464602 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=1e-64; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=2e-39; Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=2e-38; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=4e-37; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=8e-36; |
Length | 535 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GCAAACTGCCCTCAGCTCTGTGAAACTCGGCGGAAAGGTGAAGGTAACCACCGTACATTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816120 |
Trichome-related Gene from Literature | N/A |