| Detail of EST/Unigene CX541111 |
| Acc. | CX541111 |
| Internal Acc. | s13dNF77C11GS086_465512 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative serine/threonine-protein kinase/receptor R831 OS=Acanthamoeba polyphaga mimivirus E-value=4e-08; Probable serine/threonine-protein kinase drkD OS=Dictyostelium discoideum E-value=9e-08; Dual specificity protein kinase splA OS=Dictyostelium discoideum E-value=1e-07; RAF proto-oncogene serine/threonine-protein kinase OS=Rattus norvegicus E-value=2e-07; RAF proto-oncogene serine/threonine-protein kinase OS=Mus musculus E-value=2e-07; |
| Length | 547 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GGATATCGTAAGGGCTGTACGTGCAATGAATGAAACACTAAAGCAAAATCGTCTTATAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04366 RAF proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04366 RAF proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04366 RAF proto-oncogene serine/threonine-protein kinase |
| EC | 2.7.11.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825033 |
| Trichome-related Gene from Literature | N/A |