Detail of EST/Unigene CX541210 |
Acc. | CX541210 |
Internal Acc. | s13dNF78E04GS035_465716 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glucose 6-dehydrogenase OS=Glycine max E-value=9e-89; Probable UDP-glucose 6-dehydrogenase 2 OS=Arabidopsis thaliana E-value=1e-87; Probable UDP-glucose 6-dehydrogenase 1 OS=Arabidopsis thaliana E-value=6e-87; UDP-glucose 6-dehydrogenase OS=Drosophila melanogaster E-value=1e-73; UDP-glucose 6-dehydrogenase OS=Pongo abelii E-value=6e-71; |
Length | 642 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GCGAGAATGATAGCCGATGTTTCAAGATCAAACAAAATTGTCGTTGAGAAATCAACTGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00053 Ascorbate and aldarate metabolism > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00012 UDPglucose 6-dehydrogenase |
EC | 1.1.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833928 |
Trichome-related Gene from Literature | N/A |