Detail of EST/Unigene CX541331 |
Acc. | CX541331 |
Internal Acc. | s13dNF72H07GS064_465958 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase-like 6 OS=Arabidopsis thaliana E-value=6e-60; 4-coumarate--CoA ligase-like 3 OS=Oryza sativa subsp. japonica E-value=2e-53; 4-coumarate--CoA ligase-like 2 OS=Oryza sativa subsp. japonica E-value=4e-50; 4-coumarate--CoA ligase-like 9 OS=Arabidopsis thaliana E-value=2e-41; 4-coumarate--CoA ligase-like 4 OS=Oryza sativa subsp. japonica E-value=2e-40; |
Length | 537 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GGTAATAAGGAAATATGACATTGATGAGGCTATTAGGGCGATTGATAAATATAAAGTTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
EC | 6.2.1.12 6.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
Probeset |
|
Corresponding NCBI Gene | 827639 |
Trichome-related Gene from Literature | N/A |