Detail of EST/Unigene CX541475 |
Acc. | CX541475 |
Internal Acc. | s13dNF44C06GS050_466252 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 16 OS=Arabidopsis thaliana E-value=6e-43; Beta-glucosidase 12 OS=Arabidopsis thaliana E-value=1e-42; Beta-glucosidase 13 OS=Arabidopsis thaliana E-value=2e-42; Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=3e-42; Beta-glucosidase 15 OS=Arabidopsis thaliana E-value=9e-42; |
Length | 530 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GCAATTGTGTTAGATTTACTACTCTAAGAAATGGAGTTCTCATTGGTCCAAAGGCTGCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825183 |
Trichome-related Gene from Literature | N/A |