Detail of EST/Unigene CX541543 |
Acc. | CX541543 |
Internal Acc. | s13dNF87C05GS038_466388 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate kinase, cytosolic isozyme OS=Glycine max E-value=8e-15; Pyruvate kinase, cytosolic isozyme OS=Solanum tuberosum E-value=5e-14; Pyruvate kinase OS=Eimeria tenella E-value=2e-12; Pyruvate kinase, cytosolic isozyme OS=Nicotiana tabacum E-value=2e-12; Pyruvate kinase OS=Agaricus bisporus E-value=6e-12; |
Length | 549 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GGAGAAGTTGGAGTTTCTCCTTAAAACTGAAATTTTCTCTCAGTTATTTTGGATCCTATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00873 pyruvate kinase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00873 pyruvate kinase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00873 pyruvate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00873 pyruvate kinase |
EC | 2.7.1.40 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824465 |
Trichome-related Gene from Literature | N/A |