| Detail of EST/Unigene CX541625 |
| Acc. | CX541625 |
| Internal Acc. | s13dNF48D10GS090_466552 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase nodule isozyme OS=Medicago sativa E-value=1e-70; Glutamine synthetase root isozyme A OS=Pisum sativum E-value=6e-69; Glutamine synthetase root isozyme B OS=Pisum sativum E-value=2e-68; Glutamine synthetase PR-2 OS=Phaseolus vulgaris E-value=2e-67; Glutamine synthetase nodule isozyme OS=Vigna aconitifolia E-value=5e-66; |
| Length | 580 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GAAAAGCTAGAGATTCCTCTATAGCTATTTGTCTATTACTTGCTTTTCACACACTGTGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
| EC | 6.3.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821050 |
| Trichome-related Gene from Literature | N/A |