Detail of EST/Unigene CX541625 |
Acc. | CX541625 |
Internal Acc. | s13dNF48D10GS090_466552 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase nodule isozyme OS=Medicago sativa E-value=1e-70; Glutamine synthetase root isozyme A OS=Pisum sativum E-value=6e-69; Glutamine synthetase root isozyme B OS=Pisum sativum E-value=2e-68; Glutamine synthetase PR-2 OS=Phaseolus vulgaris E-value=2e-67; Glutamine synthetase nodule isozyme OS=Vigna aconitifolia E-value=5e-66; |
Length | 580 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GAAAAGCTAGAGATTCCTCTATAGCTATTTGTCTATTACTTGCTTTTCACACACTGTGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821050 |
Trichome-related Gene from Literature | N/A |