Detail of EST/Unigene CX541732 |
Acc. | CX541732 |
Internal Acc. | s13dNF91H02GS028_466766 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protease Do-like 2, chloroplastic OS=Arabidopsis thaliana E-value=0; Protease Do-like 9 OS=Arabidopsis thaliana E-value=2e-76; Protease Do-like 4, mitochondrial OS=Arabidopsis thaliana E-value=1e-51; Protease Do-like 10, mitochondrial OS=Arabidopsis thaliana E-value=2e-51; Putative protease Do-like 3, mitochondrial OS=Arabidopsis thaliana E-value=4e-48; |
Length | 630 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GGAAACTATTAACCAACGCACATTGTGTGGAGCACGATACACAGGTTAAGGTCAAGAGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.21.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819406 |
Trichome-related Gene from Literature | N/A |