Detail of EST/Unigene CX542021 |
Acc. | CX542021 |
Internal Acc. | s13dNF89B02GS025_467350 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 44 OS=Arabidopsis thaliana E-value=2e-70; Beta-glucosidase 43 OS=Arabidopsis thaliana E-value=5e-61; Beta-glucosidase 1 OS=Oryza sativa subsp. japonica E-value=6e-61; Beta-glucosidase 26 OS=Oryza sativa subsp. japonica E-value=2e-56; Beta-glucosidase 8 OS=Oryza sativa subsp. japonica E-value=6e-50; |
Length | 563 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GCAACAGATTGATCGATTACTTGCTAGAAAAGGGTAATTTTTTATGTATCCCTAGTCGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821333 |
Trichome-related Gene from Literature | N/A |