Detail of EST/Unigene CX542096 |
Acc. | CX542096 |
Internal Acc. | s13dNF85B04GS041_467500 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome c1-1, heme protein, mitochondrial OS=Solanum tuberosum E-value=1e-84; Cytochrome c1-2, heme protein, mitochondrial (Fragment) OS=Solanum tuberosum E-value=2e-84; Cytochrome c1, heme protein, mitochondrial OS=Mus musculus E-value=2e-52; Cytochrome c1, heme protein, mitochondrial OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) E-value=3e-52; Cytochrome c1, heme protein, mitochondrial OS=Bos taurus E-value=6e-52; |
Length | 624 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GGGAAGATGGCCCTAATGATGAGGGTGAGATGTTTACACGCCCTGGTAAACTCAGTGATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00190 Oxidative phosphorylation > K00413 ubiquinol-cytochrome c reductase cytochrome c1 subunit |
EC | 1.10.2.2 |
Transcription Factor Family | |
Transporter Classification Family | 3.D.3 Proton-translocating quinol-cyt c reductase superfamily QCR |
Probeset |
|
Corresponding NCBI Gene | 834081 |
Trichome-related Gene from Literature | N/A |