Detail of EST/Unigene CX542116 |
Acc. | CX542116 |
Internal Acc. | s13dNF85C12GS098_467540 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide cyclase 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-53; Allene oxide cyclase 4, chloroplastic OS=Arabidopsis thaliana E-value=3e-53; Allene oxide cyclase 2, chloroplastic OS=Arabidopsis thaliana E-value=7e-50; Allene oxide cyclase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-49; |
Length | 611 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GATCACCTTCAATGGCATCCATGAGTTCTTTGAAAATGATTTCTTCCCTCAACCTTTCTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822169 |
Trichome-related Gene from Literature | N/A |