Detail of EST/Unigene CX542165 |
Acc. | CX542165 |
Internal Acc. | s13dNF86A09GS067_467638 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-29; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=5e-29; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=1e-28; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=7e-28; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=6e-22; |
Length | 566 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GGTCATCACCACCACCACCATGTCTATCACTTCCACCACTCCACTCTTCAAATCCCTAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835090 |
Trichome-related Gene from Literature | N/A |