| Detail of EST/Unigene CX542187 |
| Acc. | CX542187 |
| Internal Acc. | s13dNF86C11GS084_467682 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 5'-adenylylsulfate reductase 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-10; Probable 5'-adenylylsulfate reductase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-10; 5'-adenylylsulfate reductase 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-10; 5'-adenylylsulfate reductase 2, chloroplastic OS=Arabidopsis thaliana E-value=7e-09; |
| Length | 394 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GGAAGCTTCCCCACAATACTCTTCTTCCCCAAACACTCTTCTCGGCCGATTAAGTATCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828288 |
| Trichome-related Gene from Literature | N/A |