Detail of EST/Unigene CX542443 |
Acc. | CX542443 |
Internal Acc. | s13dNF94C05GS035_468202 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=1e-30; Cytochrome P450 71B9 OS=Arabidopsis thaliana E-value=8e-29; Angelicin synthase (Fragment) OS=Pastinaca sativa E-value=1e-28; Cytochrome P450 71D10 OS=Glycine max E-value=1e-28; Cytochrome P450 71A9 OS=Glycine max E-value=2e-28; |
Length | 560 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED; |
Sequence | GATTTTCTATCAACAAAGAAAACAAAGTTAACAACTAAATCTCTTTTTCCTTTTCATAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829277 |
Trichome-related Gene from Literature | N/A |